Hans Talhoffer #fundie christianforums.com
Lying is immoral. Truth is moral. Since as the OP proves, evolution is immoral, evolution is therefore a lie, QED.
Lying is immoral. Truth is moral. Since as the OP proves, evolution is immoral, evolution is therefore a lie, QED.
Unicorns get off the Ark, gallop (or fly) to the southern regions of Pangaea, get pregnant, have tree sloths; gallop or fly to another part, get pregnant, have aardvarks.
Later, God breaks off a chunk of Pangaea, moves it to the eastern hemisphere, along with these tree sloths, and voila -- tree sloths in South America.
Ditto for the aardvark.
Easy as delivering the newspaper.
(After the previous poster stated her children went to public school and are fine.)
1. Were your children sexually touched by a teacher or other students? If no, you were LUCKY, because these days many kids are being introduced to sex and being sexually molested at school by other kids and even sometimes teachers. You cannot trust a young child to be safe in schools.
2. Are your children devout Christians today who sincerely and truly love Jesus and want to serve Jesus? Yes or No?
3. Children are very open and impressionable and teachable at young age, and they will become conditioned, programmed and even brainwashed to believe whatever they are being exposed to the most. So having your child around teachers and students who are unbelievers in Christ and following the world, wiccan, new age, antichristian beliefs, will influence your child immensely and may make or break your child in growing up to love Jesus or follow another path.
4. Jesus set a good example. Spend most of your time surrounded by like minded people, believers. And only spend a little time around unbelievers.
2 Corinthians 6:14 Do not be yoked together with unbelievers. For what do righteousness and wickedness have in common? Or what fellowship can light have with darkness?
5. Only mature Christians should spend a lot of time around unbelievers, when they are sharing the good news about Jesus or helping those in need. Sending a young child to an atheist/agnostic/wiccan/new age environment is not only dangerous, it's very likely to have a life long affect on that child's beliefs about Jesus. Children are being PROGRAMMED, and are not in a position to teach other children about Jesus, because sadly, there is more darkness in schools than there is light.
No Christian parent should ever send their child to school, it's too risky, mentally, emotionally, physically and spiritually. If they are not getting bullied, or sexually molested, they are being programmed and brainwashed with sexuality, body image, Darwinism and Atheism and Witchcraft and Harry Potter Sorcery!
[I've always wondered why god always chose the ignorant, meek, humble and illiterate to reveal his precepts to.]
He says why -- to confound Homo sapienism:
1 Corinthians 1:27a But God hath chosen the foolish things of the world to confound the wise;
[Homo Sapienism?! What on earth is that meant to mean?]
The belief that we are Homo sapiens, along with all the scientific justification and associated rhetoric.
You don't get it, do you?
We're not Homo sapiens -- we're real men.
Flatland: Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc
Please give us an example of what "new code" would look like.
------------------
Heaven-Sent: how about adding any letter besides a, c, g, or t.
No, it's no joke. The school system has partnered with the COMMUNIST government of China FOR MONEY and knowingly foisted their propaganda upon AMERICAN schoolchildren! The COMMUNIST government of China has been criticized for calling their program "Confucius" Institute because the COMMUNIST Chairman MAO despised Confucionism. It's another "slight of hand" LIE to insidiously GET into places that they aren't normally allowed into.
Ok, I'm sick of mentally-deranged liberal FREAKS calling people racist! It is not racist to not want communism OR Islam in our schools, in our hallowed places or their brand of "peace" in our community. This is AMERICA and this armed republic will fight to defend it! The only way your twisted globalist agenda is going to "win" is if you join forces with the DEVIL after the born again Christians are gone! Then, those who followed it are going to burn in hell for eternity.
No, this is not a joke at all.
DO YOU have any idea what that HELL-BOUND Communist Government in China does to Christians?
The Beast is creeping into my kid's school!
--------------------------------------------------------------------------------
It turns out that my kid's school is participating in a program called Confucius Institute. It is a propaganda tool of the Communist Chinese Government to infiltrate and indoctrinate the young minds of the USA.
It is full of liberal spin to put people's mind at ease...you know what I mean... like terrorists are called "freedom fighters" and the ground zero mosque is called "community center" and dead child is called "contents of the uterus that is extracted".
Anyway, this drive to "fundamentally transform the United States of America" into a globalist society has hit home. They are teaching the kids all about Chinese language, culture and beliefs in hopes that by 2021, communist China and their abominable belief system is widely accepted here in America.
Let's not forget what they do to Christians in Communist China.
It is insidious and evil.
The U.S. should demand that religious equality be showed to Christians in Saudi Arabia (and all parts of the world). And we should be willing to back up such demands with physical force.
Honestly, you can't have total religious freedom. So while we are drawing lines in the sand it doesn't seem too illogical to go ahead and outlaw a faith that is rather dangerous to those who do not adhear to the said faith. Should we allow the people to serve Kali? Lets just bring back the Thuggee and why not Baal worship? Why not let people let "their children pass through the fire"--its religious freedom after all!
As to the "Community Center", they are--by law allowed to build where they please. So long as the funding is not tax payer money, they have the right to build it, even if it is in very poor taste. Personally I would like to see the laws changed to forbid Muslims from entering America, or living therein.
When Islamic nations are free for non-muslims to visit/live with equal rights--then maybe we can start a two-way street.
Why support a faith that does not show the same support for our citizens?
The military wants any control over such craft as they want the technology, which is why in almost every case a ship lands or crashes it is always secured and shipped off to a non disclosed military base to be studied. Thousands of videos on the web showing aliens and ships both. Some are really disturbing such as Jane and Scott in Washington that encountered and alien that killed them (it was recorded as they were taping their hiking trip), anyways don't watch it if you are easy to scare. Then there are videos of good aliens who one had a personal meeting with using hand gestures to communicate, then the 64 children and some teachers watched a ship land in the school yard and talk telepathic to the children and warn them to take better care of this world. Just two cases of thousands upon thousands, including the mass sightings in Mexico (worth watching) of hundreds of ships crossing the skies. It is pretty hard to deny such hard evidence, even when a lot of it is from the military itself and they don't get paid to make stuff up.
What political party dropped a nuclear bomb on the civiliam population of their enemy?
Which ideology introduced the killing of of hundreds of millions of unborn human beings for convenience sake?
Liberalsim has introduced every STD and drug plague that has ever harmed mankind. Liberals seem very much at ease with socialism and communism, which both limit freedoms of individuals in every place they are employed, and/or, kill off people in numbers that stagger the mind.
Conservativism is an ideology that has limits to what totalitarianism can do and conservatives have shown throughout history that they are willing to die for the freedoms of others. Liberalsim embraces an odd mixture of totalitarianism and unbridled excess full fold, which history has proven is thedeadliest form of implemented ideologies of all time.
Now, which is the most dangerous form of belief system?
When compared to stacked up dead bodies . . . how is liberalism not the most harmful belief system in history?
I personally believe that UFO sightings which are not accountable for under natural causes or of earthly construction are demonic. In the case of visible sightings of physical air/space crafts, why are the pilots of these crafts, (if they are occupied that is,) so very consistently illusive? If they are occupied by intelligent, higher order beings from within, (or even perhaps from without,) our galaxy, then they of necessity possess an impressive degree of profound intelligence, so then why are they not acting intelligently with us? They obviously are aware that they are at the 3'rd planet from our sun (!!!), and must surely also know that we know that they are here, so why continue to play this childish game of hide and seek as though they were still trying to keep their presence here a secret, when it should be clear to them by now that their presence has long been known? They seem to, (at times at least,) allow for their crafts to be visibly seen by humanity over populated areas, while almost never allowing the occupants themselves to be seen....why? Why do they almost invariably allow for the crafts to be seen but not the operators of those crafts? If they were manned by spirits from hell though, this terrible possibility would instantly explain for their reluctance to have what is inside of the crafts identified. And, from what I have learned so far of how demons operate in general...they all tend to be very, very illusive, and for a very good reason.
[On why Atheists are stigmatised in the Western World]
This is because atheists have this collective aura of bitterness and negativity. It's repulsive. It's off-putting. It drives people away. You can't just demand courtesy and respect from other people if you treat them like garbage. This is the Golden Rule.
[Could someone who agrees that President Obama has mismanaged this oil spill give a brief list of what he could have done in order to win your approval and better handle this crisis?]
A brief list consisting of two items. I can't claim credit for the first, as it comes from another blog. He could jam the nearly 53,000,000 dead American preborns into the opening of the gushing oil pipe. (Yes, 53,000,000 folks, during the Carter administration, Planned Parenthood started taking so much flak for the startling number of abortions performed so soon after Roe V Wade that for a while they only reported about 1 in 3 abortions)
And second, he could just resign.
[Can we philosophically “prove” that God must be good?]
The argument I love most against Atheism is this. If Atheism is true, then all Atheists have absolute knowledge and can know everything (we know that this isn't true because of disagreement so this hinders Atheism, but for the sake of argument..). If Atheists can know everything, then they are just as knowledgeable as what we define to be God. This makes Atheists God. Therefore God is an Atheist. YIKES! shoddy logic.
["My son is involved in a Christian School Play and he tells me that the major roles which are normally played by males are being played by females. I don't think there is a shortage of males available - even if there is a shortage, does this make it right?"]
Your justifications are warranted.
Females should *never* play male roles.
Today's "Christian schools" are not what they used to be (although I have always been a proponent of having young Christian men and women grow up among unbelievers in public school to build toughness and grit); I would be wary of anyone trying to sell me on a religious education today unless I knew, by courseload what both classroom and extra curricular activities would be.
Although I would not pull your child out, you should make your criticisms known to the school administrator and explain to your son what the proper roles for male/female are.
Our society is submerged in a sex-drenched culture so hedonistic that we are, in many respects coming close to "Rome."
Drama is an *excellent* tool for teaching poise to young men and women ... but proper roles should not only be defined but vigorously defended.
[Regarding books from the horror, fantasy, and science fiction genres.]
I've had experience with some friends that read books like these. I wouldn't say that they were "possessed" however they acted much differently after reading these books. Some of the books that brought about this change did not even appear aesthetically evil until I noticed their effects. Ever since then I've avoided most books at all costs except of course the Bible. It seems to have been doing me some good because I have not been taken over by evil spirits yet.
[re: The Virginia State Seal showing a naked breast]
Naked breasts offend Jesus, since Eve committed the original sin, we must not gaze upon a woman as if to lust after her, and we must strike out all of the so called "ART" that glorifies nudity. The ancients knew this and created fig leaf covers for the statues that the pagan godless Romans had everywhere. We must continue to clean up Jesus' earth, and make it pure for his return.
(On Obama's health care bill)
This question is easily solved: If the bishops are against the bill, they are right. If the bishops support the bill, they are wrong and acting against tradition and the teachings of the Catholic Church. If they support the bill, they are modernists and could get excommunicated.
Without doubt atheists are a sad bunch. But, we still need to study their positions. Watch the Richard Dawkins/John Lennox debate online and see how pitiful Dawkins actually looks when confronted. Also, Dinesh D'Souza has many of his debates with atheists and agnostics on his website. Once confronted in person, where they cannot hide behind lengthy prose of a book, the elitest atheist looks more like an angry-grumpy old man stuttering his weathered positions through angry teeth.
There is very low potential of helping a child during the 6 hours they are in a school, when the child had to go back into 18 hours of parents that set a very low lifestyle example.
A better way to deal with this situation is to get rid of guilty parents. America needs to have an Absolute Paternity Law that say parents must provide for their children. Failure to provide for their children (as proved by asking for government assistance) should be punishable by death using the three strikes and you are out concept.
[re: Render unto Caesar what is Caesar's]
That statement shows to me Jesus had a sense of humor.
What belongs to Caesar?
It was like Jesus was saying, render nothing to Caesar, because nothing belongs to Caesar.
I am so tired of all these sexual abominations destroying our society! Everytime I see a sexually perverted woman, lesbian or something, I want to whip her hard. Women are to be disciplined, so says the Bible. Like we Catholics always did during the good old days.. Especially in countries like Spain or Italy, or Croatia. Croatian women are really beautiful. They make me think of angels, that's damn hot!
I agree with Mr. Limbaugh. sea turtles dont serve humans in any way so theyre is no point to them
[FSTDT/CTSTDT twofer]
the History channel called Moses a dictator in one of their programs
its all illuminati controlled Anti-Christian brainwashing
expect to see more and more of it
[Ascythian can you link to some published works of those people? I somehow doubt we'll be seeing many credited reports but I'm intrigued to see what kind of investigations they've done and how they've gone about interpreting what they've collected.
These people may exist but it's what they've contributed to the scientific community which should be focused on in this debate.]
And what exactly have evolutionists ever contributed to anything?
All the theory of evolution has done is promote poor morality, promoted abortion, homosexuality (and other bad acts) and gave rise to bad ideologies such as Liberalism, Socialism, Communism and Nazism.
Open Homosexuals within the ranks of the military is not conducive to high standard of work, esprit de corps, etc.
As an American Infantryman serving on Active Duty, I am whole heartedly against removing the "don't ask don't tell" policy.
Are homosexuals going to be given different quarters and latrines? They should, we don't allow women and men to shower together, neither should they force straight men to shower with sodomites. I need to know that my buddies are watching my back, not watching my backside. Many people will not re-enlist if they remove this policy, or so I feel from a general concensus.
Mainstream so-called "scientists" worship and sacrifice at the idolatrous altar of the allegedly infallible demon lord Darwin, therefore they are not allowed to admit that the ancients had spaceships and UFOs as described in the Bible and the Mahabharata.
The theory of evolution was only devised for political reasons (it's modern believers only believe in it for political reasons, not because of the scientific evidence).
The great star Wormwood (a brown dwarf star) is now in the night sky, I have tracked it now for 6 months, naked eye, infrared binoculars and high powered binoculars it has 7 Moons and a corona that is 2 million miles wide. It is what all sky, space related web sites are calling Jupiter and right now Earth is about 6 months away from passing Wormwood close up and the destruction it will cause inbound to the Sun is in Revelation Ch 8
and the outbound destruction is in Rev Ch 16
No. I have no reason to believe gravity as we know it existed. The forces and balance of forces may have been quite different. Ever wonder how they built the early pyramids?
No evidence exists for gravity as we know it, to have existed, why would I need to disprove it???
Just my thoughts on a subject.
If we consider abortion to be morally wrong on the level of murder, then it logically extends that we ought to punish the mother if she was complicit in the abortion process.
I got to thinking how law enforcement officials could prove beyong a reasonable doubt that an abortion had taken place, and the only conclusion I could come to is that women should be mandated to recieve maybe quarterly examinations of their uterus, under threat of jail if they refuse. Or maybe make pregnant women register and then if they "miscarry" then an exam will be ordered.
Women who have been found to have undergone abortion should be held as accomplices to murder, maybe conspirators as well, and then punished according to our preexisting laws on the subject.
If I really feel abortion is murder, then it necessarily follows that the people responsible for the murder ought to be punished. Retributive punishment will deter and influence women away from baby-producing activities, and hopefully reduce the amount of abortions.
"Are... are you now disputing the existance of DNA???"
Yes. DNA can never be proven. Evolutionists are obsessed with it because they always say ''chimps share 97% DNA with modern man'' etc. That's great, however you would then need to prove DNA is real.
We are the Nephilim. Surely Adam was created as a giant.
A Discovery Channel (don't criticize me on that; I don't agree with evolution) documentary showed that most species before the dinosaurs were giants. So why can't humans have been giants?
It might be more ridiculous then aliens and angels, but I think it's more biblical.
Guns & the Bible?
Sounds like peas and carrots to me. There will be a day where it will take my gun to keep my Bible.
Dearest brothers and sisters,
Wormwood, more commonly known as planet X is fast approaching. It is less than 3 years out. The Russians just launched a rocket at it, but we all know this is nothing to the Hand of ALmighty.
This planet, which is the size of Jupiter is causing global warming. It is also, causing other serious damage to our planet.
It brings with it, it's own gravitational pull, that WILL, change the rotation of our planet, and cause the winds to stop, the waters to stop, and the leaves to be still.
This will last 3 days. Then as the earths rotation changes direction, as the X falls in behind the sun, the water in your toilets will flush exactly opposite. The rivers will flow opposite. The quakes will be unimaginable, and like birthpangs will increase until the son of perdition is come.
The sop, a/c, maitreya is to arrive at this time. Perhaps on a meteor or some other heavenly body, but his advent is nigh.
But I will tell you this, again: american socialist liberals have NO-right,
to change the USA-constitution, according to utterly selfish whims, including the complete annihilation of humanity, Satan's ultimate aim. - He, & they, have already lost! - tho in the meantime, billions more will perish. - How God can have mercy upon devilish souls, is quite frankly no small miracle.
---I do understand what he said. He said that because I don't believe in his god, I deserve to have my beloved pets die a horrible death.---
Then you didn't get it. He said God was trying to drive you to him, by killing your ducks.
Which to a Christian means, God is personally trying to extend his love to you.
I for one, being a United States Infantryman, believe that if Trijicon puts any reference to the Bible on their optics then it is there right. Trijicon makes THE best optics (scopes) that I have ever used, or seen. I carried a Trijicon ACOG (Advanced Combat Optical Gunsight) in Iraq last year and I can tell you that just about anyone in the military will agree that they make the best optics for most commonly issued small-arms.
I never even knew about that Bible verse on my scope until it came up in the news. Do I care? No, in fact I find it kind of nice. Its like giving one back to the Jihadists. While other servicemen may have joined up for "Freeing Iraq" or whatever, I joined "Pro Dues et Patria"--"For God and Country", I joined to fight and kill Islamic Jihadists.
The struggle over there is one between Islam and Christianity, but sadly only the Jihadists seem to make that clear. They are not politically correct. While everyone is entitled to their opinion mine is thus: If Trijicon were forced to remove their "hidden Bible code" from their product they should cease from working with the U.S. Government, Trijicon has the best product and they should deserve to be able to place a Bible reference. For those who find this distrubing, then please give your money away, because as far as I am aware--"In God We Trust!" still is seen on legal tender.
The concept that a human being requires sentience is subjective. Not everyone agrees. What about puberty? Why not draw the line there? Sure the organism just before puberty is sentient and can feel pain but who are vyou to say thats the subjective criteria if others disagree with you?
Anyway the whole issue can be solved by saying dont have sex unless one wants the responsibilty of conception. And isnt that what its all about sexual license? Of course it is. The next question will be so am I saying do with out sex, and the answer is yes! thats what it says in the Bible its for procreation. If people can't do without sex, and one doesn't need it, then sex must be their god.
[But, the incestuous nature of the relationship of Adam and Eve (cloned from his rib) and their children (siblings with siblings) is something you happily ignore, because it DOESN'T suit your agenda.]
It really is sad that God can tell you in His word that it is good, and you try to turn it into incest. SMH
I can't help that your mind is dirty. Go is always HOLY. And by His decree, a husband is joined to his wife. So you can quit with the whole sibling angle. Once they were joined as husband and wife, they weren't siblings anymore.
Science, or better said sorcery, has told us that some defiant people are just born that way, but ask any that has come back from their defiance, and you will know that the sorcerers are just grasping at straws on this topic.
The tilt of the axis was not caused by the flood but rather the flood was caused by the tilt of the axis (the birth of Venus).
"In the lifetime of [Emperor] Yao the sun did not set for ten full days and the entire land was flooded." -- Johannes Hübner, evangelist, 1729
AV1611VET: There is no such thing as abiogenesis. Which came first in the universe, life or the earth?
ArnautDaniel: Uh, I think even creationists would say "earth"...unless you have some weird image of living things floating around in space.
AV1611VET: Angels --- they were present when the earth was created:
I can't speak for AV but I interpret scientism as being a fundamentalist religious cult belief that atheist scientists are infallible and have a monopoly on truth.
The corollary to this is that Wikipedia should be treated as infallible holy scriptures that can never be questioned.
So for example, scientism states that viruses can give birth to humans, meteorites do not exist because they are in the Bible, parthenogenesis is impossible because Mary was a virgin, the Milky Way is the entire universe because Harlow Shapley said so, etc.
We should occupy them and give them the blessed King James Bible (the only real bible) make them celeibrate christian things like Christmas and thanksgiving, otherwise I would not consider Iraq to be truly intergrated into the United States.
[after having people explain to him that you can not get your identity stolen by people finding your DNA samples]
people can use your dna for anything. its foolish to just start handing out that kind of information, ESPECIALLY ON INTERNET FORUM. god gave you your dna in a manner that scientists do not yet understand, that is probably why genetics is such a complicated subject. this thread takes it all for granted, and mocks god at that! evolution is the lie that keeps on giving. i will pray for the ignorant who deny our lord and desperately need to be saved
A person needs to spend 80-90% of his time reading the bible, if not 95-100%.
On principle, I think vaccines are great (our older kids got all of them), but once we found out that our second son was severely autistic and thimerosal (a preservative in some vaccines) was implicated, we became more cautious. Somewhere along the way we found out about the aborted fetal cells, too.
I have a pet hunch that, instead of thimerosal, a curse borne of those cells may be the culprit...
[In response to the post, "As others have pointed out.....end of apartheid =/= government mismanagement" on a thread questioning the moral standing of ending apartheid]
so which is better then. Bad living conditions with no racial considerations, or good living conditions with racial consideration?
This kinda reminds me of some of the slaves who didn't want to leave their positons because they had good owners, good shelter, and comfortable living conditions. Which would you chose? Comfortable conditions as a slave, or miserable conditions as a free-man. Think hard before answering..